Updating Information on GenBank Records
The following information provides the different methods to submit updates to GenBank in order to ensure that your update is processed quickly and correctly. Updates provided in an incorrect format will delay processing. All update files should be saved as plain text. If you are updating multiple records, please send a list of all accessions to be updated at the top of your request.
Do not submit a new Sequin file to update an existing record.
Update files in the formats below should be emailed directly to [email protected] or uploaded using UpdateMacroSend .
Update Formats:
Editing Source Information
Send updates to the source information (i.e. strain, cultivar, country, specimen_voucher) in a multi-column tab-delimited table, for example:
acc. num. strain country organism AYxxxx02 82 USA Escherichia coli AYxxxx03 ABC Canada Bacillus subtilis
Updating Publication Information
Replace any non-ASCII characters (for example, characters with accents and umlauts) with the appropriate English letters. Send updates to the publication information in a multi-column tab-delimited table, for example:
acc. num. authors title FJxxxx01 John A. Smith Identification of gene A FJxxxx02 Xu P. Weng, Jane Doe Identification of gene B
The complete list of revised author names should be provided in the following format:
given_name middle_initial surname, etc.
These are the valid publication fields which should be used in the column headers:
- authors
- journal
- volume
- issue
- pages
- publication date
- title
- affiliation
- department
- city
- state
- publication country
- street
- postal code
- *PMID
- **class
All columns may not be appropriate for each reference. Use only the relevant columns. If the reference has been published, include the complete journal title, not an abbreviation.
*If the publication has a PubMed identifier (PMID), it is not necessary to supply any of the remaining publication fields. It is sufficient to send a table with accession number and PMID only.
**The class descriptor should only be used when the publication status has been changed. This descriptor has a controlled vocabulary and may only include one of the following three class values:
- unpublished
- in-press journal
- journal
Nucleotide Sequence Update
If you are updating the current nucleotide sequence send the complete new sequence(s) in fasta format:
>AYxxxx02 cggtaataatggaccttggaccccggcaaagcggagagac >AYxxxx03 ggaccttggaccccggcaaagcggagagaccggtaataat
Please do not send a list of nucleotide changes. Do not include non-IUPAC characters within the sequence. Use n's for unknown nucleotides within the sequence.
Update features on record without annotation
If you are adding annotation to a record that has none, then send us the features as a tab-delimited 5-column Feature table. For example:
>Feature gb|EFxxxxxx|EFxxxxxx
<1 400 gene
gene ENO1
<1 30 CDS
70 300
product enolase
note homodimer
<1 30 mRNA
70 400
product enolase
<1 30 exon
number 1
70 400 exon
number 2
Update features on record with annotation
If you are updating many features of a record, let us know, and we can send you a tab-delimited 5-column Feature table with the current annotation for you to edit and return to us.